Back to the blog index.
The genomic sequence for H5N1.
agcaaaagcaggggtctgatctgtcaaaatggagaaaatagtacttcttcttgcaatagtcagtcttgttaaaagtgatcagatttgcattggttaccatgcaaacaactcgacagagcaggttgacacaataatggaaaagaacgttactgttacacatgcccaagacatactggaaaagacacacaacgggaagctctgcgatctagatggagtgaagcctctaattttgagagattgtagtgtagctggatggctcctcggaaacccaatgtgtgacgaattcatcaatgtgccggaatggtcttacatagtagagaaggccaatccagccaatgacctctgttacccaggggatttcaacgactatgaagaactgaaacacctattgagcagaataaaccattttgagaaaattcagatcatccccaaaagttcttggtccaatcatgaaacctcatcaggggtgagctcagcatgtccataccagggaaagtcctcctttttcagaaatgtggtatggcttatcaaaaagaacagtgcatacccaacaataaagaggagctacaataataccaaccaagaagatcttttggtactgtgggggattcaccatcctaatgatgcggcagagcagacaaggctctatcaaaacccaaccacctatatttccgttgggacatcaacactaaaccagagattggtaccaaaaatagctactagatccaaagtaaacgggcaaagtggaaggatggagttcttctggacaattttaaaaccgaatgatgcaatcaacttcgagagtaatggaaatttcattgctccagaatatgcatacaaaattgtcaagaaaggggactcagcaattatgaaaagtgaattggaatatggtagctgcaacaccaagtgtcaaactccaatgggggcgataaactctagtatgccattccacaatatacaccctctcaccatcggggaatgccccaaatatgtgaaatcaaacagattagtccttgcgactgggctcagaaatagccctcaaagagagagaagaagaaaaaagagaggactatttggagctatagcaggttttatagagggaggatggcagggaatggtagatggttggtatgggtaccaccatagcaatgagcaggggagtgggtacgctgcagacaaagaatccactcaaaaggcaatagatggagtcaccaataaggtcaactcgatcattgacaaaatgaacactcagtttgaggccgttggaagggaatttaataacttagaaaggagaatagagaatttaaacaagaagatggaagacggatttctagatgtctggacttataatgctgaacttctggttctcatggaaaatgagagaactctagactttcatgactcgaatgtcaagaacctttacgacaaggtccgactacagcttagggataatgcaaaggagctgggtaacggttgtttcgagttctatcacaaatgtgataatgaatgtatggaaagtgtaagaaacggaacgtatgactacccgcagtattcagaagaagcaagactaaaaagagaggaaataagtggagtaaaattggaatcaataggaacttaccaaatactgtcaatttattcaacagtggcgagttccctagcactggcaatcatggtagctggtctatctttatggatgtgctccaatggatcgttacaatgcagaatttgcatttaaatttgtgagttcagattgtagttaaaaacacccttgtttctactagcaaaagcaggagtttaaaatgaatccaaatcagaagataataaccatcggatcaatctgtatggtaattggaatagttagcttaatgttacaaattgggaacatgatctcaatatgggtcagtcattcaattcagacagggaatcaacaccaagctgaaccaatcagcaatactaattttcttactgagaaagctgtggcttcagtaacattagcgggcaattcacctctttgccccattagcggatgggctgtacacagtaaggacaacagtataaggatcggttccaagggggatgtgtttgttataagagagccgttcatctcatgctcccacttggaatgcagaactttctttttgactcagggagccttgctgaatgacaagcactccaatgggactgtcaaagacagaagccctcacagaacattaatgagttgtcctgtgggtgaggctccctccccatataactcaaggtttgagtctgttgcttggtcagcaagtgcttgccatgatggcaccagttggttgacaattggaatttctggcccagacaatggggctgtggctgtattgaaatacaatggcataataacagacactatcaagagttggaggaacaacatactgagaactcaagagtctgaatgtgcatgtgtaaatggctcttgctttactgtaatgactgatggaccaagtaatgggcaggcatcatataagatcttcaaaatggaaaaagggaaagtggttaaatcagtcgaattggatgctcctaattatcactatgaggagtgctcctgttatcctgatgccggcgaaatcacatgtgtgtgcagggataattggcatggctcaaatcggccatgggtatctttcaatcaaaatttggagtatcaaataggatatatatgcagtggagttttcggagacaatccacgccccaatgatggaacaggtagttgtggtccggtgtcccctaacggggcatatggggtaaaagggttttcatttaaatacggcaatggtgtttggatcgggagaaccaaaagcactaattccaggagcggctttgaaatgatttgggatccaaatgggtggactggaacggacagtagcttttcggtgaaacaagatatcgtagcaataactgattggtcaggatatagcgggagttttgttcagcatccagaactgacaggattagattgcataagaccttgtttctgggttgagttaatcagagggcggcccaaagagagcacaatttggactagtgggagcagcatatctttttgtggtgtaaatagtgacactgtgggttggtcttggccagacggtgctgagttgccattcaccattgacaagtagtttgttgaaaaaactccttgtttctactagcaaaagcaggtcaaatatattcaatatggagagaataaaagaattaagagatctaatgtcacagtcccgcactcgcgagatactaacaaaaaccactgtggaccatatggccataatcaagaaatacacatcaggaagaaaagagaagaaccctgctctcagaatgaaatggatgatggcaatgaaatatccaatcacagcggacaagagaataatagagatgattcctgaaaggaatgaacaagggcagacgctctggagcaagacaaatgatgctggctcggacagggtgatggtgtctcccctagctgtaacttggtggaataggaatgggccgacgacaagtgctgtccattatccaaaggtttacaaaacatactttgagaaggttgaaaggttaaaacatggaaccttcggtcccgttcatttccgaaaccaagttaaaatacgccgccgagttgatataaatcctggccatgcagatctcagtgctaaagaagcacaagatgtcatcatggaggtcgttttcccaaatgaagtgggagctagaatattgacatcagagtcgcaactgacaataacgaaagagaagaaagaagagctccaagattgtaagattgctcccttaatggttgcatacatgttggaaagggaactggtccgcaaaaccagattcctaccggtagcaggcggaacaagcagtgtgtacattgaggtattgcatttgactcaagggacctgctgggaacagatgtacactccaggcggagaagtgagaaatgacgatgttgaccagagtttgatcatcgctgccagaaacattgttaggagagcaacggtatcagcggatccactggcatcactgctggagatgtgtcacagcacacaaattggtgggataaggatggtggacatccttaggcaaaatccaactgaggaacaagctgtggatatatgcaaagcagcaatgggtctgaggatcagttcatcctttagctttggaggcttcactttcaaaagaacaagtggatcatccgtcaagaaggaagaggaagtgcttacaggcaacctccaaacattgaaaataagagtacatgaggggtatgaggaattcacaatggttgggcggagggcaacagctatcctgaggaaagcaactagaaggctgattcagttgatagtaagtggaagagacgaacaatcaatcgctgaggcaatcattgtagcaatggtgttctcacaggaggattgcatgataaaggcagtccgaggcgatctgaatttcgtaaacagagcaaaccaaagattaaaccccatgcatcaactcctaagacattttcaaaaggatgcaaaagtgctatttcagaattggggaattgaacccattgataatgtcatggggatgatcggaatattacctgacatgactcccagcacagaaatgtcactgagaggagtaagagttagtaaaatgggagtggatgagtattccagcactgagagagtagttgtaagtattgaccgtttcttaagggttcgagatcagcgggggaacgtactcttatctcccgaagaggtcagcgaaacccagggaacagagaaattgacaataacatattcatcatcaatgatgtgggaaatcaacggtcctgagtcagtgcttgttaacacctatcaatggatcatcagaaactgggagactgtgaagattcaatggtctcaagaccccacgatgctgtacaataagatggagtttgaaccgttccaatccttggtacctaaagctgccagaggtcaatacagtggatttgtgagaacattattccaacaaatgcgtgacgtactggggacatttgatactgtccagataataaagctgctaccatttgcagcagccccaccggagcagagcagaatgcagttttcttctctaactgtgaatgtgaggggctcaggaatgagaatactcgtaaggggcaattcccctgtgttcaactacaataaggcaaccaaaaggcttaccgttcttggaaaggacgcaggtgcattaacagaggatccagatgaggggacagccggagtggaatctgcagtactgaggggattcctaattctaggcaaggaggacaaaagatatggaccagcattgagcatcaatgaactgagcaatcttgcgaaaggggagaaagctaatgtgctgatagggcaaggagacgtggtgttggtaatgaaacggaaacgggactctagcatacttactgacagccagacagcgaccaaaagaattcggatggccatcaattagtgtcgagttgtttaaaaacgaccttgtttctactagcaaaagcaggcaaaccatttgaatggatgtcaatccgactttacttttcttgaaagtaccagtgcaaaatgctataagtaccacattcccttatactggagaccctccatacagccatggaacagggacaggatacaccatggacacagtcaacagaacacaccaatattcagaaaaggggaagtggacaacaaacacagagactggagcaccccaactcaacccgattgatggaccactacctgaggataatgagcccagtgggtatgcacaaacagattgtgtattggaagcaatggctttccttgaagaatcccacccagggatctttgaaaactcgtgtcttgaaacgatggaaattgttcaacaaacaagagtggataaactgacccaaggtcgccagacctatgactggacattgaatagaaaccaaccggctgcaactgctttggccaacactatagaaatcttcagatcgaacggtctaacagccaatgaatcgggacggctaatagatttcctcaaggatgtgatggaatcaatggataaggaagaaatggagataacaacacatttccagagaaagagaagagtgagggacaacatgaccaagaaaatggtcacacaaagaacaatagggaagaaaaaacaaaggctgaacaaaaagagctacctgataagagcactgacactgaacacaatgacaaaagatgcagaaagaggcaaattgaagaggcgagcaattgcaacacccggaatgcaaatcagaggattcgtgtactttgttgaaacactagcgaggagtatctgtgagaaacttgagcaatctggactcccagtcggagggaatgagaagaaggctaaattggcaaacgtcgtgaggaagatgatgactaactcacaagatactgaactctcctttacaattactggagacaataccaaatggaatgagaatcagaatcctaggatgtttctggcaatgataacgtacatcacaaggaaccaaccagaatggtttcggaatgtcttaagcattgcccctataatgttctcaaacaaaatggcgagattaggaaaaggatacatgttcgaaagtaagagcatgaagttacgaacacaaataccagcagaaatgcttgcaaacattgatcttaaatacttcaatgaattaacgaaaaagaaaattgagaaaataagacctctattaatagatggtacagcctcattgagccctggaatgatgatgggcatgttcaacatgctgagtacagtcctaggagtctcaatcctgaatcttggacagaaaaggtacaccaaaaccacatattggtgggacggactccaatcctctgatgatttcgctctcatcgtaaatgcaccgaatcatgagggaatacaagcaggagtggataggttttataggacttgtaaactagttggaatcaatatgagcaagaagaagtcttacataaatcggacagggacatttgaattcacgagctttttctaccgctatggatttgtagccaatttcagtatggagctgcccagttttggagtgtctggaattaatgaatcggccgacatgagcattggtgttacagtgataaagaacaatatgataaacaacgaccttgggccagcaacagctcagatggctcttcagctattcatcaaggactacagatacacataccgatgccacagaggggatacgcaaatccaaacaaggagatcattcgagctgaagaagctgtgggagcaaacccgttcaaaggcagggctgttggtttcagatggaggaccaaacctatacaatatccgaaatctccatattcctgaggtctgcttgaaatgggaattgatggatgaagattaccagggcagactgtgtaatcctctgaatccgttcgtcagccataaggaaattgaatctgtcaacaatgctgtagtaatgccagctcatggcccggccaagagtatggaatatgatgccgttgcaactacacattcatggattcctaaaaggaatcgttccattctcaatacgagtcaaaggggaattcttgaggatgaacagatgtaccagaagtgctgcaatctattcgagaaattcttccccagcagttcatatcggaggccagttggaatttccagcatggtggaggccatggtgtctagggcccgaattgacgcacgaattgatttcgagtctggaaggattaagaaagaagagtttgctgagatcatgaagatctgttccaccattgaagagctcagacggcaaaaatagtgaatttagcttgtccttcgtgaaaaaatgccttgtttctactagcaaaagcaggtactgatccaaaatggaagactttgtgcgacaatgcttcaatccaatgattgtcgagcttgcggaaaaggcaatgaaagaatatggggaagatccgaaaatcgaaacgaacaaatttgctgcaatatgcacacatttggaggtctgtttcatgtattcggattttcactttattgatgaacggagtgaatcaataattgtagaatctggagatccgaatgcattattgaaacaccgatttgaaataattgaaggaagagaccgaacgatggcctggactgtggtgaatagtatctgcaacaccacaggagtcgagaaacctaaatttctcccagatttgtatgactacaaagagaaccggttcatcgaaattggagtgacacggagggaagttcatacatactatctggagaaagccaacaagataaaatccgagaagacacacattcacatattctcattcacaggggaggaaatggccaccaaagcggactacacccttgatgaagagagcagggcaagaattaaaaccaggctgttcaccataaggcaggaaatggccagtaggggtctatgggattcctttcgtcaatccgagagaggcgaagagacaattgaagaaaaatttgaaatcactggaaccatgcgcagacttgccgaccaaagtctcccaccgagcttctccagccttgaaaactttagagcctatgtggatggattcgaaccgaacggctgcattgagggcaagctttctcaaatgtcaaaagaagtgaatgctagaattgagccattttttaagacaacgccacgccctctcagattacctgatgggcctccttgctctcagcgatcgaagttcttgctgatggatgcccttaaattaagcatcgaagacccgagtcatgagggggaggggataccactatacgatgcaatcaaatgcatgaagacatttttcggctggaaagagcccaacatcgtgaaaccacatggaaaaggtataaaccccaattacctcctggcttggaagcaagtgctggcagaactccaagatattgaaaatgaggagaaaatcccaaaaacaaagaacatgaaaaaaacaagccagttgaagtgggcactcggtgagaacatggcaccagagaaagtagactttgaggactgcaaagatgttagcgatctaagacagtatgacagtgatgaaccagagtctagatcactagcaagctggattcagagtgaattcaacaaggcatgtgaattgacagattcgagttggattgaacttgatgaaataggagaggacgttgctccaattgagcacattgcaagtatgagaaggaactattttacagcggaagtatcccattgcagggccactgaatacataatgaagggagtgtacataaacacagccctgttgaatgcatcctgtgcagccatggatgactttcaactgattccaatgataagcaaatgcagaaccaaagaaggaagacggaaaactaatctgtatggattcattataaaaggaagatcccacttgaggaatgataccgatgtggtaaattttgtgagtatggaattctctcttactgatccgaggctggagccacacaagtgggaaaagtactgtgtcctcgagataggagacatgctcctccggactgcagtaggccaagtttcaaggcccatgttcctgtatgtgagaaccaacggaacctccaagatcaaaatgaaatggggcatggaaatgaggcgatgccttcttcaatcccttcaacaaattgaaagcatgattgaagctgagtcttctgtcaaagagaaggacatgaccaaagaattctttgaaaacaaatcagaaacatggccgattggagagtcccccaaaggagtggaggaaggatccatcggaaaggtgtgcagaaccttgctggcgaagtctgtgttcaacagtttatatgcatctccacaactcgaggggttttcagctgaatcaagaaaattgcttctcattgctcaggcacttagggacaacctggaacctgggaccttcgatcttggagggctatatgaagcaattgaggagtgcctgattaacgatccctgggttttgcttaatgcgtcttggttcaactccttcctcgcacatgcactgaaatagttgtggcaatgctactatttgctatccatactgtccaaaaaagtaccttgtttctactagcaaaagcagggtagataatcactcaccgagtgacatcaacatcatggcgtctcaaggcaccaaacgatcttatgaacagatggaaactggtggagaacgccagaatgctactgagatcagggcatctgttggaagaatggttagtggcattgggaggttctacatacagatgtgcacagaactcaaactcagtgactatgaagggaggctgatccagaacagcataacaatagagagaatggtactctctgcatttgatgaaagaaggaacagatacctggaagaacaccccagtgcggggaaggacccgaagaaaactggaggtccaatttatcggaggagagacgggaaatgggtgagagagctgattctgtacgacaaagaggagatcaggaggatttggcgtcaagcgaacaatggagaggacgcaactgctggtcttacccacctgatgatatggcattccaatctaaatgatgccacatatcagagaacgagagctctcgtgcgtactggaatggaccccaggatgtgctctctgatgcaagggtcaactctcccgaggagatctggagctgccggtgcagcagtaaagggggtagggacaatggtgatggagctgattcggatgataaaacgagggatcaacgaccggaatttctggagaggcgaaaatggaagaagaacaaggattgcatacgagagaatgtgcaacatcctcaaagggaaattccaaacagcagcacaaagagcaatgatggatcaagtgcgagagagcagaaatcctgggaatgctgaaattgaagatctcatttttctggcacggtctgcactcatcctgagaggatcagtggcccataagtcctgcttgcctgcttgtgtgtacggacttgcagtggccagtggatatgactttgagagagaagggtactctctggttggaatagatcctttccgtctgcttcaaaacagccaggtctttagtctcattagaccaaatgagaatccagcacataagagtcaattagtgtggatggcatgccactctgcagcatttgaggaccttagagtctcaagtttcatcagagggacaagagtggtcccaagaggacagctatccaccagaggggttcaaattgcttcaaatgagaacatggaagcaatggactccaacactcttgaactgagaagtagatattgggctataagaaccagaagcggaggaaacaccaaccagcagagggcatctgcaggacagatcagcgttcagcccactttctcggtacagagaaaccttcccttcgaaagagcgaccattatggcagcatttacaggaaatactgagggcagaacgtctgacatgaggactgaaatcataagaatgatggaaagtgccagaccagaagatgtgtcattccaggggcggggagtcttcgagctctcggacgaaaaggcaacgaacccgatcgtgccttcctttgacatgaataatgaaggatcttatttcttcggagacaatgcagaggagtatgacaattaaagaaaaatacccttgtttctactagcaaaagcaggtagatgttgaaagatgagtcttctaaccgaggtcgaaacgtacgttctctctatcatcccgtcaggccccctcaaagccgagatcgcgcagaaacttgaagatgtctttgcaggaaagaacaccgatctcgaggctctcatggagtggctaaagacaagaccaatcctgtcacctctgactaaagggattttgggatttgtattcacgctcaccgtgcccagtgagcgaggactgcagcgtagacgctttgtccagaatgccctaaatggaaatggagatccaaataatatggatagggcagttaagctatataagaagctgaaaagagaaataacattccatggggctaaggaggtcgcactcagctactcaaccggtgcacttgccagttgcatgggtctcatatacaacaggatgggaacggtgactacggaagtggcttttggcctagtgtgtgccacttgtgagcagattgcagattcacagcatcggtctcacagacagatggcaactatcaccaacccactaatcaggcatgagaacagaatggtgctggccagcactacagctaaggctatggagcagatggcgggatcaagtgagcaggcagcggaagccatggaggtcgctaatcaggctaggcagatggtgcaggcaatgaggacaattgggactcatcctaactctagtgctggtctgagagataatcttcttgaaaatttgcaggcctaccagaaacgaatgggagtgcagatgcagcgattcaagtgatcttcttgttgttgccgcaaatatcattgggatattgcacttgatattgtggattcttgatcgtcttttcttcaaatgcatttatcgtcgccttaaatacggtttgaaaagagggccttttacggcaggggtacctgagtctatgagggaagagtaccggcaggaacagcagagtgctgtggatgttgacgatggtcattttgtcaacatagaattggagtaaaaaactaccttgtttctactagcaaaagcagggtgataaaaacataatggattccaacactgtgtcaagctttcaggtagactgctttctttggcatgtccgcaaacgatttgcagaccaagaactgggtgatgccccattccttgaccggcttcgccgagatcagaagtccctaagaggaagaggcaacactcttggtctggacatcgaaacagctactcgtgcgggaaagcagatagtggagcggattctggaggaggagtctgatgaggcacttaaaatgccggcttcacgctacctaactgacatgactctcgaagaaatgtcaagggactggttcatgctcatgcccaagcagaaagtggcaggttccctttgcatcaaaatggaccaggcaataatggataaaaccatcatattgaaagcaaacttcagtgtgatttttgaccggttggaaaccctaatactacttagagctttcacagaagaaggagcaatcgtgggagaaatctcaccattaccttctcttccaggacatactggtgaggatgtcaaaaatgcaattggcgtcctcatcggaggacttgaatggaatgataacacagttcgagtctctgaaactatacagagattcgcttggagaagcagtgatgaggatgggagacttccactccctccaaatcagaaacggaaaatggcgagaacaattgagtcagaagtttgaagaaataaggtggctgattgaagaagtacgacatagattgaaaattacagaaaacagcttcgaacagataacgtttatgcaagccttacaactactgcttgaagtggagcaagagataagagccttctcgtttcagcttatttaatgataaaaaacacccttgtttctact